circad | circRNAs associated with diseases

hsa_circ_0000523
Gene	METTL3	Organism	Human
Genome Locus	chr14:21971315-21972024:-	Build	hg19
Disease	Colorectal Cancer	ICD-10	Malignant neoplasm of rectosigmoid junction (C19)
DBLink	Link to database	PMID	30403259
Experimental Method
Sample Type	Cell lines	Comparison	n/a
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CAGCATCGGAACCAGCAAAG Reverse CTGGGCTGTCACTACGGAAG	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Jin, Y, Yu, LL, Zhang, B, Liu, CF, Chen, Y (2018). Circular RNA hsa_circ_0000523 regulates the proliferation and apoptosis of colorectal cancer cells as miRNA sponge. Braz. J. Med. Biol. Res., 51, 12:e7811.